Generates a fasta file from a metabarlist object, typically for a subset of MOTUs of interest.
fasta_generator(
metabarlist,
id = rownames(metabarlist$motus),
output_file = NULL,
annotation = NULL,
annot_sep = ";"
)a metabarlist object.
a character vector containing identifiers for the MOTUs of interest. Default is the row names of table `motus`
the path/name of the output file.
a data frame containing the additional information to be added in the sequence header. Each row name is a MOTU identifier and each column header is the information key (correspond to "key=" in the fasta header). Default: NULL
the annotation separator. Default is ";"
a fasta file
Creates a fasta file from a set of sequences of interest. A single or multiple pieces of sequence information can be added to the sequence header via the `annotation` table. Using the default parameters, the resulting fasta file will have the following format:
>Seq_id1 abundance=83079; GC=47 tcaatctcgtgtgactaaacgccacttgtccctctaagaagttacgccgacagaatgcgatcggcgaactatttagcaggctagagtctcgttcgttat >Seq_id2 abundance=120520; GC=55 ctcaaacttccttggcctggaaggccatagtccctctaagaagctggccgcggagggtcacctccgcatagctagttagcaggctgaggtctcgttcgttaa
data(soil_euk)
dir <- tempdir()
fasta_file_path <- file.path(dir, "Dominants.fasta")
## Export in fasta format the 10 most abundant MOTUs
idx <- order(soil_euk$motus$count, decreasing = TRUE)[1:10]
fasta_generator(soil_euk, rownames(soil_euk$motus)[idx],
fasta_file_path
)
## Export in fasta format the 10 most abundant MOTUs, their abundance and the GC content
# of the corresponding sequence
annotation <- data.frame(
abundance = soil_euk$motus$count[idx],
GC_content = soil_euk$motus$GC_content[idx],
row.names = rownames(soil_euk$motus)[idx]
)
fasta_generator(
soil_euk, rownames(soil_euk$motus)[idx],
fasta_file_path,
annotation
)